MCQ Question for Class 12 Biology Chapter 6 Molecular Basis of Inheritance

Check the below NCERT MCQ Class 12 Biology Chapter 6 Molecular Basis of Inheritance with Answers available with PDF free download. MCQ Questions for Class 12 Biology with Answers were prepared based on the latest syllabus and examination pattern issued by CBSE, NCERT and KVS. Our teachers have provided below Molecular Basis of Inheritance Class 12 Biology MCQs Questions with answers which will help students to revise and get more marks in exams

Molecular Basis of Inheritance Class 12 Biology MCQs Questions with Answers

Refer below for MCQ Class 12 Biology Chapter 6 Molecular Basis of Inheritance with solutions. Solve questions and compare with the answers provided below

Question. A sequence of DNA to be transcribed is 5’ATTGCCATT3’ coding strand 3’TAACGGTAA5’ template strand. Give the sequence of RNA transcribed
(a) 5’ATTGCCATT3’
(b) 3’UAACGGUAA5’
(c) 5’UAACGGUAA3’
(d) 5’AUUGCCAUU3’

Question. Which RNA Brings amino acids and reads genetic code?
(a) t–RNA
(b) r–RNA
(c) m–RNA
(d) None of the above

Question. Structural and catalytic role is of which RNA?
(a) m RNA
(b) t RNA
(c) r RNA
(d) hn RNA

Question. Function of t RNA is
(a) To bring the aminoacids
(b) To read the genetic code
(c) Both (a) and (b)
(d) To give catalytic property

Question. RNA polymerase requires which factor for initiation
(a) Rho
(b) Alpha
(c) Sigma
(d) Pi

Question. Which one of the following pairs of codons is correctly matched with their function or the signal for the particular amino acid?
(a) AUG, ACG – Start/methionine
(b) UUA, UCA – Leucine
(c) GUU, GCU – Alanine
(d) UAG, UGA – Stop

Question. Purines found both in DNA and RNA are
(a) cytosine and thymine
(b) adenine and thymine
(c) adenine and guanine
(d) guanine and cytosine.

Question. Which of the following is initiation codon?
(a) UAG
(b) AUC
(c) AUG
(d) CCU

Question. What are the structures called that give an appearance as ‘beads-on-string’ in the chromosomes when viewed under electron microscope?
(a) Genes
(b) Nucleotides
(c) Nucleosomes
(d) Base pairs

Question. Which one of the following statements about the particular entity is true ?
(a) Centromere is found in animal cells, which produces aster during cell division.
(b) The gene for producing insulin is present in every body cell.
(c) Nucleosome is formed of nucleotides.
(d) DNA consists of core of eight histones

Question. The following ratio is generally constant for a given species:
(a) A + G / C + T
(b) T + C / G + A
(c) G + C / A + T
(d) A + C / T + G.

Question. In prokaryotes, the genetic material is
(a) linear DNA without histones
(b) circular DNA without histones
(c) linear DNA with histones
(d) circular DNA with histones.

Question. One turn of the helix in a B-form DNA is approximately
(a) 2 nm
(b) 20 nm
(c) 0.34 nm
(d) 3.4 nm.

Question. A DNA with unequal nitrogen bases would most probably be
(a) single stranded
(b) double stranded
(c) triple stranded
(d) four stranded. 

Question. The experimental proof for semi-conservative replication of DNA was first shown in a
(a) fungus
(b) bacterium
(c) plant
(d) virus.

Question. The final proof for DNA as the genetic material came from the experiments of
(a) Hershey and Chase
(b) Avery, MacLeod and McCarty
(c) Hargobind Khorana
(d) Griffith.

Question. DNA synthesis can be specifically measured by estimating the incorporation of radio-labelled
(a) thymidine
(b) deoxyribose sugar
(c) uracil
(d) adenine.

Question. Similarity in DNA and RNA is that
(a) both are polymer of nucleotides
(b) both have similar pyrimidine
(c) both have similar sugar
(d) both are genetic material.

Question. There are special proteins that help to open up DNA double helix in front of the replication fork. These proteins are
(a) DNA ligase
(b) DNA topoisomerase I
(c) DNA gyrase
(d) DNA polymerase I.

Question. The stretch of codons between AUG and a stop codon is called
a) open reading frame
b) TATA box
c) colinearity
d) degenerate

Question. If a DNA contains 1000 base pairs, what would be its length?
a) 3400 Å
b) 34000 Å
c) 6800
d) 1000 Å

Question. Genes which are active all the time synthesizing substances needed by the cell are called
a) Cellular luxury genes
b) metabolic genes
c) house keeping genes
d) control genes

Question. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes
a) RNA polymerase II
b) RNA primase
c) RNA polymerase III
d) RNA polymerase I

Question. What is not True for DNA in prokaryotes
a) present in the form of a compact structure called nucleoid
b) the coils are maintained by non-histone basic proteins
c) found in cytoplasm in a supercoiled condition
d) packaged as nucleosomes along with histones

Question. In the following questions, a statement of Assertion (A) is followed by a statement of Reason (R).
(1) If both Assertion and Reason are true and the reason is the correct explanation of the assertion, then mark (a)
(2) If both Assertion and Reason are true but the reason is not the correct explanation of the assertion, then mark (b)
(3) If Assertion is true but Reason are false, then mark (c)
(4) If both Assertion and Reason are false, then mark (d)

Assertion: In Griffith’s experiment mice were injected by a mixture of heat killed Smooth type bacteria and live Rough type bacteria. Some mice died of pneumonia and their blood contained both live Rough type bacteria and live Smooth type bacteria
Reason: The dead Smooth type bacteria became alive and caused pneumonia. Griffith named it as transforming principle. 

Question. A bacterial colony containing DNA made up of 100% N15 nitrogen bases is allowed to replicate in a medium containing N14 bases. After one round of replication the result would be
a) All individuals will be identical to parents
b) All individuals will be hybrids
c) Only 50% individuals would be hybrids
d) All individuals would have DNA made up of 100% N14

Question. If a double stranded DNA has 20% Thymine, the percentage of Guanine in the DNA
a) 30%
b) 10%
c) 90%
d) 40%

Question. Cistron is
a) The coding sequence of DNA
b) The functional unit of DNA molecule that codes for a particular gene product
c) Intervening non coding sequence of DNA
d) The sequences which are removed during RNA splicing.

Question. Read the statements given below and identify the incorrect statement.
a) The human genome contains 3164.7 million nucleotide bases.
b) The average gene consists of 30,000 bp
c) The total number of genes is estimated at 30,000.
d) Chromosome Y has 231 genes
e) Less than 2% of the genome codes for proteins.

Question. In a nucleotide, the nitrogen base is joined to the sugar molecule by
a) Phosphodiester bond
b) Glycosidic bond
c) Hydrogen bond
d) (a) &(b)

Question. Sickle cell anemia is caused
a) When valine is replaced by glutamic acid in beta polypeptide chain
b) When glutamic acid is replaced by valine in beta polypeptide chain
c) When glutamic acid is replaced by valine in alpha polypeptide chain
d) When valine is replaced by glutamic acid in alpha polypeptide chain

Question. Teminism is
a) a central dogma reverse
b) a central dogma of molecular biology
c) a circular flow of hereditary material
d) an effect of cytoplasm on functioning of DNA

Question. Peptidyl transferase
a) Is a 23s rRNA
b) forms peptide bonds
c) component of ribosome
d) all the three

Question. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG

Question. ‘Lac operon’ in E. coli, is induced by
(a) ‘I’ gene
(b) promoter gene
(c) β-galactosidase
(d) lactose.

Question. Experimental material in the study of DNA replication has been
(a) Escherichia coli
(b) Neurospora crassa
(c) Pneumococcus
(d) Drosophila melanogaster.

Question. Select the correct statement.
(a) Franklin Stahl coined the term ‘‘linkage’’.
(b) Punnett square was developed by a British scientist.
(c) Spliceosomes take part in translation.
(d) Transduction was discovered by S. Altman.

Question. The equivalent of a structural gene is
(a) muton
(b) cistron
(c) operon
(d) recon.

Question. Ribosomal RNA is actively synthesised in
(a) lysosomes
(b) nucleolus
(c) nucleoplasm
(d) ribosomes.

Question. In DNA helix, cytosine is paired with guanine by
(a) covalent bond
(b) phosphate bond
(c) three hydrogen bonds
(d) two hydrogen bonds

Question. Telomerase is an enzyme which is a
(a) simple protein
(b) RNA
(c) ribonucleoprotein
(d) repetitive DNA.

Question. Which of the following reunites the exon segments after RNA splicing?
(a) RNA polymerase
(b) RNA primase
(c) RNA ligase
(d) RNA proteoses

Question. In DNA, when AGCT occurs, their association is as per which of the following pair?
(a) AT-GC
(b) AG-CT
(c) AC-GT
(d) All of these

Question. In three dimensional view the molecule of tRNA is
(a) L-shaped
(b) S-shaped
(c) Y-shaped
(d) E-shaped.

Question. The process of transfer of genetic information from DNA to RNA/formation of RNA from DNA is
(a) transversion
(b) transcription
(c) translation
(d) translocation.

Question. Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?
(a) Genetic code is specific.
(b) Genetic code is not ambiguous.
(c) Genetic code is redundant.
(d) Genetic code is nearly universal.

Question. The total number of nitrogenous bases in human genome is estimated to be about
(a) 3.5 million
(b) 35 thousand
(c) 35 million
(d) 3.1 billion

Question. In an inducible operon, the genes are
(a) usually not expressed unless a signal turns them”on”.
(b) usually expressed unless a signal turns them “off”.
(c) never expressed
(d) always expresser.

Question. Which one of the following is the starter codon?
(a) UAA
(b) UAG
(c) AUG
(d) UGA

Question. Which one of the following triplet codes, is correctly matched with its specificity for an amino acid in protein synthesis or as ‘start’ or ‘stop’ codon ? D
(a) UCG – Start
(b) UUU – Stop
(c) UGU – Leucine
(d) UAC – Tyrosine

Question. If the DNA codons are ATG ATG ATG and a cytosine base is inserted at the beginning, then which of the following will result?
(a) CAT GAT GAT G
(b) A non-sense mutation
(c) C ATG ATG ATG
(d) CA TGA TGA TG

Question. Genetic code consists of
(a) adenine and guanine
(b) cytosine and uracil
(c) cytosine and guanine
(d) all of these.

Question. A complex of ribosomes attached to a single strand of RNA is known as
(a) polypeptide
(b) Okazaki fragment
(c) polysome
(d) polymer

Question. Using imprints from a plate with complete medium and carrying bacterial colonies, you can select streptomycin resistant mutants and prove that such mutations do not originate as adaptation. These imprints need to be used
(a) on plates with and without streptomycin
(b) on plates with minimal medium
(c) only on plates with streptomycin
(d) only on plates without streptomycin.

Question. Protein synthesis in an animal cell, takes place
(a) in the cytoplasm as well as endoplasmic reticulum
(b) only on ribose attached to nucleon
(c) only in the cytoplasm
(d) in the nucleolus as well as in the cytoplasm.

Question. All of the following are part of an operon except
(a) an operator
(b) structural genes
(c) an enhancer
(d) a promoter.

Question. In E. coli, during lactose metabolism repressor binds to
(a) regulator gene
(b) operator gene
(c) structural gene
(d) promoter gene.

Question. In operon concept, regulator gene functions as
(a) inhibitor
(b) repressor
(c) regulator
(d) all of these.

Question. What is it that forms the basis of DNA finger-printing?
(a) The relative proportions of purines and pyrimidine in DNA.
(b) The relative difference in the DNA occurrence in blood, skin and saliva.
(c) The relative amount of DNA in the ridges and grooves of the fingerprints.
(d) Satellite DNA occurring as highly repeated short DNA segments.

Question. DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the
(a) template strand
(b) coding strand
(c) alpha strand
(d) antistrand.

We hope you liked MCQ Class 12 Biology Chapter 6 Molecular Basis of Inheritance with answers provided above. Incase you have any questions please post them in the comments section below and our Biology teachers will provide a response.